Screening of rpsL mutations in streptomycin resistance gene of 104 strains of Yersinia pestis strains in south area of Qinghai Province by TaqMan-MGB fluorescent probe / 中国热带医学

@#Abstract: Objective To investigate the current status of streptomycin resistance of Yersinia pestis caused by point mutations of rpsL gene in Qinghai, so as to provide theoretical basis for precise clinical medication and prevention of drug resistance of human plague outbreak in South area of Qinghai Province in the future. Methods A total of 104 representative strains of Yersinia pestis collected from plague patients, vector insects and intermediate hosts in South area of Qinghai Province from 1957 to 2009 were screened, isolated and cultured by Hiss agar plates. The DNA of representative Yersinia pestis was extracted by sodium dodecyl sulfate lysis and phenol-chloroform method. The primers forward primer and reverse primer and TaqMan-MGB probes probe1 [FAM] and probe2 [VIC] were designed for the rpsL gene of streptomycin resistance gene in China. Real-time PCR with TaqMan-MGB fluorescent probe was used to detect the mutations of rpsL gene in streptomycin resistance locus of 104 strains of Yersinia pestis in South area of Qinghai Province. Results The FAM test results of 104 strains in South area of Qinghai Province were positive, corresponding to the detection of rpsL (128 : A ), RFU peak >1 000,negative <200. VIC test results of all tested strains were negative, corresponding to the detection of rpsL (128:G), RFU peak <200, positive >1 000. That is, no strains with rpsL gene mutation related to streptomycin resistance were found in the 104 strains of Yersinia pestis in Qingnan Province. Conclusion This study provides basic data on the distribution of streptomycin resistance of Yersinia pestis in South area of Qinghai Province, and lays a foundation for preventing the occurrence of drug resistance and clinical treatment of Yersinia pestis in South area of Qinghai Province.

Establishment of duplex TaqMan RT-PCR method for detection of Entamoeba histolytica and Giardia lamblia in fecal sample / 中国热带医学

@#Abstract: Objective To establish the duplex TaqMan RT-PCR method for detection of Entamoeba histolytica and Giardia lamblia in fecal samples. Methods Primer pairs and probes for Entamoeba histolytica and Giardia lamblia were designed and duplex TaqMan RT-PCR amplification system was constructed. PCR products were inserted into the pUC57 plasmid, and the lower limit of detection of the method was determined. Clinical stool samples were tested in order to evaluated the efficacy of the method. Results The detection limits of duplex TaqMan RT-PCR were 31.6 copies/μL for Entamoeba histolytica and 32 copies/μL for Giardia lamblia, respectively. Of the total of 212 clinical stool samples tested, all 3 samples with E. histolytica-positive patients by microscopy were positive by PCR, while 1 from 209 samples with E. histolytica-negative patients by microscopy were positive by PCR, and the remaining samples were negative. For Giardia lamblia, all 8 samples positive by microscopy were positive by PCR, and 1 from 204 sample with a microscopy-negative patient was positive by PCR, and the remaining samples were negative. The amplification product sequencing and blast analysis were used to confirm that the amplified sequence in the specimen of a patient with negative microscopy but positive PCR belongs to the targeted pathogen, supported by clinical symptoms and laboratory test results. PCR results for other diarrhea-causing pathogens were negative, indicating no cross-reactivity. Conclusions The dual TaqMan RT-PCR method developed in this study can not only detect microscopy-positive samples of Entamoeba histolytica and Giardia lamblia but also can detect samples that were missed by microscopy, with higher sensitivity than the microscopy method. Further, this detection method does not cross-react with other diarrhea-causing pathogens, including cross-react with other diarrhea-causing pathogens including Iodamoeba butschlii, Blastocystis hominis, Plesiomonas, Aeromonas, Salmonella, Shigella, Sphaerozoum fuscum, and Entamoeba hartmani, thus has a good specificity.

Development and verification of multiplex fluorescence quantitative PCR (Taqman probe) for detection of telomerase activity / 中国生物制品学杂志

@#Objective To develop and verify a multiplex fluorescence quantitative PCR(Taqman probe) method for the detection of telomerase activity.Methods Specific reverse transcription primers,two pairs of quantitative primers and probes were designed for the CDS sequence of telomerase catalytic subunit telomerase reverse transcriptase(TERT).After optimization of the reverse transcription primers(specific reverse transcription primers and random primers) and quantitative primers(two pairs of quantitative primer probes used alone or in combination) in the reaction system,with the primer probe of internal reference gene GAPDH,multiplex fluorescence quantitative PCR was performed in a single tube.In addition,telomerase positive standard and negative standard were prepared with 293T and MRC-5 cells respectively,and the stability and precision of the method were verified.The telomerase activity in 19 normal mesenchymal cell samples and 32 breast cancer cell samples were detected by the developed method.Results The optimum reaction system was as follows:using cDNA synthesized with specific reverse transcription primers as the template,2 pairs of quantitative primer probes of TERT gene were mixed with internal reference gene GAPDH primer probes for multiplex fluorescence quantitative PCR reaction in a single tube.After optimization,the sensitivity and TERT fluorescence signal quantity of the system were greatly improved,and the ΔRn was enhanced by 3 times.The amplification curve of positive standard TERT gene was normal,and the ΔCt between TERT gene and GAPDH gene remained stable.The amplification curve of GAPDH gene in negative standard was normal,while there was no amplification curve of TERT gene.There was a little difference in ΔCt between TERT and GAPDH genes in the positive standard frozen and thawed for 3 and 5 times repeatedly and the positive standard without freezing and thawing,and the CVs of precision in intra-and inter-groups were all less than 1%.Telomerase activity was negative in 19 normal mesenchymal cell samples and positive in 32 breast cancer cell samples,and significant difference in Ct value of TERT gene between them was observed(t=4.236,P <0.001).Conclusion The developed multiplex fluorescence quantitative PCR(Taqman probe) method for the detection of telomerase activity has good stability and precision,which is expected to be used in early diagnosis and gene therapy of tumors.

First report on the detection of Japanese encephalitis virus in fruit bats from India

Japanese encephalitis (JE) is a mosquito borne viral zoonotic disease and JE virus (JEV) is responsible for causing several children deaths every year in India. Since 1978, cases of JE have been reported from Gorakhpur district of Uttar Pradesh state annually. The knowledge on the role played by wildlife reservoirs in the sylvatic transmission and maintenance of JE virus remains limited. Bats are reservoir hosts for several emerging and re-emerging viral pathogens but their role in zoonotic cycle of JEV has not been elucidated yet. In Gorakhpur district of Uttar Pradesh, 52 fruit bats were found dead on 26 May 2020. The post-mortem report of the bat samples conducted at the Indian Veterinary Research Institute stated that the bats died due to brain hemorrhage, caused by excessive heat. The brain tissue samples of the bats were subjected to investigation using molecular techniques to determine the presence of JEV. The present work reports for the first time the detection of JEV in brain samples of bats from India. The viral load ranging from 8 to 18 copies/reaction was detected in brain samples by TaqMan real Time RT-PCR. The low viral load might be the reason for the absence of apparent clinical signs in bats and suggests the probable role of fruit bats in maintaining the JEV in nature.

Identification of Fritillaria taibaiensis and its relatives by real-time PCR with a TaqMan-MGB probe / 药学学报

The molecular identification of Fritillaria taibaiensis and its relatives was studied by real-time PCR with a TaqMan-MGB probe. DNA was extracted from F. taibaiensis and its relatives. According to the sequence of ITS1 region, the mutation sites of F. taipaiensis and its related species were identified by MEGA7.0 software. The specific primers (a pair) and a TaqMan-MGB probe were designed by Primer Premier 6.0 software. In the Roche LightCycler 96 system, the lowest limit of detection for F. taipaiensis DNA template was 0.002 39 ng·μL-1, and the optimal Tm value range was 60 and 61 ℃. Specificity identification showed that the method had good specificity for F. taipaiensis, as it could be distinguished from other 13 different Fritillaria species including F. unibracteata. Since this method could accurately identify F. taipaiensis and its related species, it provides technical support for rational development of F. taipaiensis resources, management of Chinese medicinal market and supervision of raw materials in Chinese medicine manufacturing enterprises.

Effect of Bitis gabonica and Dendroaspis angusticeps snake venoms on apoptosis-related genes in human thymic epithelial cells

Certain environmental toxins permanently damage the thymic epithelium, accelerate immune senescence and trigger secondary immune pathologies. However, the exact underlying cellular mechanisms and pathways of permanent immune intoxication remain unknown. The aim of the present study was to demonstrate gene expressional changes of apoptosis-related cellular pathways in human thymic epithelial cells following exposure to snake venom from Bitis gabonica and Dendroaspis angusticeps. Methods: Snake venoms were characterized by analytical methods including reversed phase high-performance liquid chromatography and sodium dodecyl sulphate-polyacrylamide gel electrophoresis, then applied on human thymic epithelial cells (1889c) for 24 h at 10 μg/mL (as used in previous TaqMan Array study). Gene expressional changes restricted to apoptosis were assayed by TaqMan Array (Human Apoptosis Plate). Results: The most prominent gene expressional changes were shown by CASP5 (≈ 2.5 million-fold, confirmed by dedicated quantitative polymerase chain reaction) and CARD9 (0.016-fold) for B. gabonica, and BIRC7 (6.46-fold) and CASP1 (0.30-fold) for D. angusticeps. Conclusion: The observed apoptotic environment suggests that pyroptosis may be the dominant pathway through which B. gabonica and D. angusticeps snake venoms trigger thymic epithelial apoptosis following envenomation.(AU)

Establishment and evaluation of a TaqMan RT-qPCR method for tissue quantification of oncolytic virus M1 in vivo / 中国病理生理杂志

AIM:To establish a TaqMan RT-qPCR method for surveiling the spread of oncolytic virus M1 in tissue,helping control the dosage and assessing the safety of virus. METHODS:A TaqMan-based one-step RT-qPCR method for the detection and quantification of oncolytic virus M1 in the tissues was established. The virus load and distri-bution in the tissues of SD rats,cynomolgus monkeys and nude mice were also investigated. RESULTS:A pair of specific primers(Q3)and the standard viral RNA for SYBR Green RT-qPCR were screened and selected with the best specificity and amplification efficiency. By optimizing the experiment conditions,we found that the annealing temperature above 62℃reduced matrix effect but affected the amplification efficiency. So we established a one-step TaqMan RT-qPCR method and redesigned a pair of Q3 short primers(Q3S). Using the one-step TaqMan RT-qPCR and Q3S primer,the stan-dard RNA with low copy numbers was specifically detected under the background of mixed matrix RNA of SD rats or cyno-molgus monkeys. Furthermore,the method was verified to be suitable for detecting tissue distribution of M1 virus in the mice,SD rats and cynomolgus monkeys. CONCLUSION:The TaqMan-based one-step RT-qPCR constructed with Q3S primer can be used for M1 virus quantification in various tissue samples of different animals with better specificity and sen-sitivity,and may be further applied to the detection of clinical samples.

Genetic variant rs10937405 of TP63 and susceptibility to lung cancer risk in north Indian population

Several studies including genomewide association studies (GWASs) in diverse ethnic populations have reported a significant association of genetic variant rs10937405 of TP63 with nonsmall cell lung cancer (NSCLC). However, no data are available from any Indian population on the association of this variant with NSCLC. Using TaqMan genotyping chemistry, we conducted a case–control study involving 190 NSCLC cases and 400 ethnic, age-matched controls to explore the association of rs10937405 genetic variant with NSCLC in patients from north India. Our data support that the rs10937405 variant is also significantly associated with the NSCLC and is a risk factor in the north Indian populations to develop NSCLC. However, unlike most other studies, the wild-type allele T appears to be the risk allele, as its frequency was significantly higher in the cases than controls (0.439 in cases versus 0.383 in controls. OR=1.95 (1.23–3.09 at 95% CI); P value (adjusted)= 0.004). Genetic association was also observed by applying different genetic models. The present study provides important information of the genetic aetiology of NSCLC and strengthens GWAS findings, highlighting the role of TP63 in lung cancer risk.

Identification of Ophiocordyceps sinensis and its adulterants based on portable and CFX96 real-time fluorescent PCR systems / 药学学报

The molecular identification of Ophiocordyceps sinensis and its adulterants was carried out by real-time fluorescent PCR with TaqMan probe. Genomic DNA was extracted from 100 samples of Ophiocordyceps sinensis and its adulterants. MEGA 7.0 software was used for comparative analysis to define the variable sites between Ophiocordyceps sinensis and its adulterants according to the internal transcribed spacer (ITS) region of ribosomal DNA (rDNA). A set of specific primers and TaqMan probe were designed using Primer Premier 6.0 software, and sensitivity and specificity studies were performed on two different real-time fluorescent PCR systems (Genesig q16 and Bio-Rad CFX96). The sensitivity study showed that the detectable DNA template concentration of Ophiocordyceps sinensis for the real-time fluorescent PCR was 0.016 ng·μL-1 in the Bio-Rad CFX96 system and 15.527 ng·μL-1 in the Genesig q16 system, respectively. Meanwhile, this method had good specificity for Ophiocordyceps sinensis on Genesig q16 and Bio-Rad CFX96 systems, so Ophiocordyceps sinensis could be clearly distinguished from Ophiocordyceps nutans, Cordyceps gunnii, Cordyceps militaris, Cordyceps cicadae, Cordyceps liangshanensis, Cordyceps gracilis. Our results indicate that real-time fluorescent PCR with TaqMan probe can be used to accurately identify Ophiocordyceps sinensis from its adulterants. This provides a technical method that has wide applications for market management and quality control of Chinese materia medica.

Validation of Quantitative PCR-Taqman Probe Method for Detection of Residual NS0 Host Cell DNA / 中国药学杂志

OBJECTIVE: To validate a PCR-Taqman probe method for detection of residual DNA of NS0 host cells. METHODS: Multiple pairs of primers and probes were designed and synthesized for the NS0 genome repeat sequence, and the optimal primer probe combination was selected through experiments. Pretreatment kit (magnetic bead method) was used to enrich and purify the host cell DNA residue in the sample.According to the requirements of ICH and China Pharmacopoeia general principle No. 9101, validation of the detection method including linearity and range, accuracy,precision, specificity, quantitative limit and reference DNA calibration was carried out for self-developed residual CHO host cell DNA quantitation kit (PCR-Taqman probe).Using the intermediate product and drug substance of the monoclonal antibody process produced by NS0 cells, the test performance of the kit was verified, and five independent laboratories were organized to coordinate the calibration. RESULTS: NS0 cell DNA detection (Taqman method) forward primer sequence was CCCCTTCAGCTCCTTGGGTA, reverse primer sequence was GCCTGGCAAATACAGAAGTGG, and probe sequence was FAM-AGGGCCCCCAATGGAGGAGCT-TAMRA. The standard curve of DNA was in the range of 3 fg•μL-1 to 300 pg•μL-1 with good linearity (r2>0. 99). The deviation of the mean from the true value was less than 15% at six different concentrations. The quantitative limit was 3 fg•μL-1.The DNA calibration result of the internal reference sample was 30 μg•mL-1. Good precision (RSD≤30%) was obtained. The q-PCR method was specific for CHO DNA, which showed no responses to the DNA of E. coli, human genome DNA(kidney epithelium 293T cells), and CHO genome DNA(Chinese hamster ovary cells). In addition, the detection recovery rate was in the range of 70% to 130% with RSD less than 15% for the intermediate products and drug substance in the production process. The RSD of the five collaborative laboratories was less than 30%. CONCLUSION: The self-developed residual NS0 host cell DNA quantitation kit (PCR-Taqman probe) has good specificity, sensitivity and accuracy, and can meet the requirements of host DNA residue detection.

Performance of the IS6110-TaqMan® assay in the diagnosis of extrapulmonary tuberculosis from different biological samples

Abstract INTRODUCTION: This study evaluated the performance of the IS6110-TaqMan® assay in different types of biological samples and tissues for laboratory diagnosis of extrapulmonary tuberculosis. METHODS: 143 biological samples and tissues from patients with suspected extrapulmonary tuberculosis from the health services of Recife/Pernambuco/Brazil were evaluated with the IS6110-TaqMan® assay. RESULTS: The sensitivities of the IS6110-TaqMan® assay calculated for blood, urine, both blood and urine samples, tissue biopsies, extrapulmonary body fluid samples, and all samples from patients calculated together were 55.9%, 33.3%, 68.8%, 43.8%, 29.6%, and 73.7%, respectively, and the specificities were 80%, 100%, 78.6%, 100%, 100%, and 84.2%, respectively. CONCLUSIONS The accuracy of qPCR was high in various clinical sample types. The analysis of more than one type of clinical sample collected from the same patient with extrapulmonary tuberculosis enhances the diagnostic power of the IS6110-TaqMan® assay when compared with the use of only one clinical sample.

Development of Molecular Diagnosis Using Multiplex Real-Time PCR and T4 Phage Internal Control to Simultaneously Detect Cryptosporidium parvum, Giardia lamblia, and Cyclospora cayetanensis from Human Stool Samples

This study aimed to develop a new multiplex real-time PCR detection method for 3 species of waterborne protozoan parasites (Cryptosporidium parvum, Giardia lamblia, and Cyclospora cayetanensis) identified as major causes of traveler's diarrhea. Three target genes were specifically and simultaneously detected by the TaqMan probe method for multiple parasitic infection cases, including Cryptosporidium oocyst wall protein for C. parvum, glutamate dehydrogenase for G. lamblia, and internal transcribed spacer 1 for C. cayetanensis. Gene product 21 for bacteriophage T4 was used as an internal control DNA target for monitoring human stool DNA amplification. TaqMan probes were prepared using 4 fluorescent dyes, FAM™, HEX™, Cy5™, and CAL Fluor Red® 610 on C. parvum, G. lamblia, C. cayetanensis, and bacteriophage T4, respectively. We developed a novel primer-probe set for each parasite, a primer-probe cocktail (a mixture of primers and probes for the parasites and the internal control) for multiplex real-time PCR analysis, and a protocol for this detection method. Multiplex real-time PCR with the primer-probe cocktail successfully and specifically detected the target genes of C. parvum, G. lamblia, and C. cayetanensis in the mixed spiked human stool sample. The limit of detection for our assay was 2×10 copies for C. parvum and for C. cayetanensis, while it was 2×10³ copies for G. lamblia. We propose that the multiplex real-time PCR detection method developed here is a useful method for simultaneously diagnosing the most common causative protozoa in traveler's diarrhea.

TaqMan Real-time RT-PCR Assay for Detecting and Differentiating Japanese Encephalitis Virus / 生物医学与环境科学（英文）

<p><b>OBJECTIVE</b>To detect Japanese encephalitis virus (JEV) rapidly and distinguish its genotypes, a TaqMan-based reverse transcriptase quantitative polymerase chain reaction (RT-PCR) detection system was developed.</p><p><b>METHODS</b>By aligning the full-length sequences of JEV (G1-G5), six sets of highly specific TaqMan real-time RT-PCR primers and probes were designed based on the highly conserved NS1, NS2, and M genes of JEV, which included one set for non-specific JEV detection and five sets for the detection of specific JEV genotypes. Twenty batches of mosquito samples were used to evaluate our quantitative PCR assay.</p><p><b>RESULTS</b>With the specific assay, no other flavivirus were detected. The lower limits of detection of the system were 1 pfu/mL for JEV titers and 100 RNA copies/µL. The coefficients of variation of this real-time RT-PCR were all < 2.8%. The amplification efficiency of this method was between 90% and 103%.</p><p><b>CONCLUSION</b>A TaqMan real-time RT-PCR detection system was successfully established to detect and differentiate all five JEV genotypes.</p>

Establishment and evaluation of different serotypes group B streptococcus method by TaqMan fluorescent probe technique / 国际检验医学杂志

Objective To establish a molecular method for the identification of different serotypes of group B streptococcus(GBS)based on TaqMan fluorescence probe technology,and to lay the foundation for the sub-sequent study of multiple fluorescent probe technology to detect different serotypes of GBS.Methods Primers and probes were designed according to the different serotypes of capsular polysaccharide(CPS).CPS se-quences were amplified by real-time fluorescence quantitative polymerase chain reaction.GBS classification methods of different serotypes were established.The results were compared with latex agglutination test and the method was evaluated from the aspects of sensitivity,specificity and detection of clinical isolates.Results The logarithmic concentration of DNA in the same serotype GBS was linearly correlated with the value of Ct. The detection limit of this method is 1 pg/μL,a probe could only detect the corresponding serotype GBS.The results of TaqMan fluorescence probe test of 10 strains were consistent with the results of latex agglutination test.Conclusion TaqMan fluorescence probe technique is a simple,rapid,highly sensitive and specific method for the detection of different GBS serotypes,and it is better than latex agglutination test for the classification of clinical isolates.

Establishment and application of a TaqMan real-time fluorescence quantitative PCR for detection of tree shrew adenovirus(TAV) / 中国比较医学杂志

Objective To establish a quick and accurate method for detection of tree shrew adenovirus(TAV) using TaqMan real-time fluorescence quantitative PCR. Methods Based on the published TAV genome sequence, a 3' conserved sequence was used to design specific probe primers. A standard curve was prepared using a recombinant plasmid containing the target gene fragment. A real-time fluorescence quantitative PCR method was established for detecting TAV based on TaqMan probe. Results The detection method was specific and was not cross-reactive with other common pathogens. The detection limit of the method was 3.7 copies/μL,showing a high sensitivity. The correlation coefficient was 0.998, and the efficiency was 95.7%. The amplification result showed a fine linear relationship,and the repeatability test effect was good. Conclusions The TAV real-time quantitative PCR detection method based on TaqMan probe has been successfully established. It has high sensitivity and reproducibility and can be applied to early detection of TAV infection.

Genotyping of the offsprings of Leprdb/ +mice by TaqMan probe fluorescence quantitative PCR / 中国实验动物学报

Objective To establish an efficient method of genotyping for Leprdb/ +mouse offsprings by TaqMan probe quantitative fluorescence PCR. Methods Genome DNA was extracted from tails of 228 Leprdb/ +mouse offsprings. PCR primers and TaqMan probes were designed according to the mutation sites of Lepr gene(rs1801133). Real time PCR assay was applied and SNP loci were typed with SDS software. The genotyping of 2-month old Leprdb/dbmice was validated by the phenotype and Hardy-Weinberg equilibrium test was performed. Results 228 samples were detected by the established TaqMan fluorescence quantitative PCR assay. 64 mice were of GG genotype, with a genotype frequency of 0.1929. 123 mice were of GT genotype, with a genotype frequency of 0.5395. 41 mice were of TT genotype, with a genotype frequency of 0.2807. Compared with the phenotype typing,the sensitivity of the TaqMan fluorescence quantitative PCR was 97.56% and the specificity was 99.47%. Conclusions TaqMan probe quantitative fluorescence PCR assay is a simple and efficient method,and can be used to detect the genotype of Leprdb/ +mouse offsprings.

Establishment of a Method for the Identification of Vibrio Parahaemolyticus by Taqman-Probe Fluorescence Quantitative PCR Analysis / 现代检验医学杂志

Objective To establish a method for the identification of Vibrio parahaemolyticus based on Taqman-fluorescence probe quantitative PCR method targeting toxR gene.Methods Taking the standard strain of Vibrio parahaemolyticus (VPJS421) and other ommon pathogenic bacteria'standard strain as the research object,using the bio-software to design specific PCR primers and Taqman probe of Vibrio parahaemolyticus toxR gene and detected by fluorescence quantitative PCR instrument.Results ①The designed primers could amplify specific bands.②The amplification efficiency of the 0.5 μl probe in the amplification system was better than that of the 1.0μl probe.③The detection sensitivity of toxR gene of Vibrio parahaemolyticus by Taqman fluorescence quantitative PCR was 10-1 mg/L.④The detection method did not show positive amplification in detection of Enterococcus f aecalis,Staphylococcus aureus,Saprophytic staphylococcus,Enterobacter hormaechei,Pseudomonas aeruginosa,Escheri ch ia coli,Vibrio al ginol yticus,Vibrio vulnficus,Vibrio metschnikovii and Wbrio furnissii 10 other common pathogenic bacteria.The specificity was 100％.Conlusion The fluorescence quantitative PCR method for the identification of Vibrio parahaemolyticus was successfully established.The method was sensitivty and specificity,and it is suitable for rapid detection of Wbrio parahaemolyticus and has a good application value.

Rapid detection of human MTHFR gene polymorphism by the TaqMan-ARMS method / 临床检验杂志

Objective To establish a rapid detection method for human methylene tetrahydrofolate reductase ( MTHFR) gene polymor-phism by using the primer mismatching amplification and fluorescence quantitative PCR. Methods A total of 214 samples with differ-ent MTHFR C677T genotypes ( CC, CT, TT) or different A1298C genotypes ( AA, AC, CC) , which were verified by gene sequen-cing, were collected, and the plasmids with the corresponding wild-type and homozygous mutants were constructed, respectively. The amplification refractory mutation system ( ARMS) primers and TaqMan probes were designed based on the wild-type standard sequence of MTHFR gene, and the optimal mutation detection system was established. The results from the system were compared with the known sequencing results to verify the feasibility of the system. Results The performance of the established TaqMan-ARMS method was ex-cellent, which had 10 copies/μL of lowest detectable limit and high specificity. There was no nucleic acid amplification in the cross de-tection between samples and the negative control. In addition, the established method had good repeatability. The standard deviations of the reproducibility detection of MTHFR-667 and 1298 loci ranged from 0.11 to 0.44, and the coefficients of variation ( CV) of homozy-gous and heterozygous samples were all less than 4.52％. The consistency of the established method with the sequencing method in 214 clinical samples was 100％. Conclusion The established TaqMan-ARMS method for the detection of MTHFR gene polymorphism is simple, rapid and accurate, which may be used for the rapid diagnosis of clinical patients.

Real-time quantitative PCR assay with TaqMan probe for rapid detection of colistin resistance mcr-1 gene / 中华微生物学和免疫学杂志

Objective To establish a sensitive real-time quantitative PCR assay with TaqMan probe for rapid detection of mcr-1 gene in clinical isolated strains. Methods According to the mcr-1 gene sequence, a pair of specific primers and a TaqMan probe were designed. Moreover, a recombinant plasmid with mcr-1 gene was constructed as the positive standard. TaqMan probe-based fluorescence quantitative PCR assay was used to detect the colistin resistance gene mcr-1. The sensitivity, repeatability and specificity of the assay were evaluated. Results There was a good linear relationship between the initial template amount and Ct value (R2>0. 999). The lower limit of detection was 10 copies/μL, which was 100 times more sensitive than the conventional PCR. Results of test for specificity showed that only the strains carrying the mcr-1 gene were positive, while the remaining strains were negative. Coefficients of variation of intra-and inter-group repeatability tests were less than 1％. Two out of 150 clinical isolated strains carried mcr-1 re-sistance gene and both of them were identified as Escherichia coli. Conclusion TaqMan probe-based fluo-rescence quantitative PCR for the detection of colistin resistance gene mcr-1 was established with strong spe-cificity, high sensitivity and good repeatability. It could be used for the specific detection of clinical drug-re-sistant strains positive for mcr-1 gene and provide reference for pharmacotherapy.

Development of a New TaqMan-MGB Probe-Based Real-Time qPCR Method for the Detection of HCV-RNA / 现代检验医学杂志

Objective Developing a rapid and accurate real-time qPCR method for the detection of HCV-RNA.Methods HCV nucleotide sequence was analysed in Clustal software and primers and probe were designed in the conserved region of 5'UTR.The reaction system optimization of real-time qPCR method was used chessboard titration,pseudoviral particles were used as quantitative standard to assess the performance.New methods was compared with clinical commonly used kit of HCV-RNA and discuss the application value.Results The sensitivity of new real-time qPCR method was 50 IU/ml,coefficient variation was less than 5％.The quantitative results of this method could be traceable to national standards of GBW09151a.40 samples were determined by new methods and clinical commonly used kit of HCV-RNA,the positive concordance rate was 100 ％,the negative concordance rate was 56 ％.14 samples were positive by new method,but negative by Qiagen kit,illustrating that the sensitivity of new method was superior to Qiagen kit.Conclusion New TaqMan-MGB probe-based real-time qPCR method is a specific,sensitive,simple,rapid and exactly used to detection of HCV-RNA.